Abstract
Background:
Recessive dystrophic epidermolysis bullosa (RDEB) is a monogenic skin disorder characterized by severe skin fragility and pronounced clinical variability, even among individuals sharing identical genotypes. Transforming growth factor beta 1 (TGF-β1) and Interleukin-6 (IL-6) signaling have previously been linked to disease severity, but the molecular changes of long-term exposure of patient keratinocytes (KCs) - especially at the level of DNA methylation and gene expression - remain relatively unexplored.
Methods:
Data on differential DNA-methylation and gene expression were generated from RDEB-KCs following a 4-week exposure to TGF-β1 or IL-6, as well as after an additional 4-week period without treatment, using the EPIC array and RNA-sequencing, respectively. Cytokine induced epigenetic and transcriptional alterations upon treatment and such that remained stable upon treatment withdrawal were identified using bioinformatic tools based on R/Bioconductor packages for data integration and analysis.
Results:
Bioinformatic analysis demonstrated that prolonged cytokine exposure, reflecting chronic inflammation, induced predominantly reversible but also a subset of long-lasting transcriptomic changes in RDEB-KCs. Notably, pathways associated with the RDEB disease phenotype were enriched, with focal adhesion and p53 signaling among the stably altered pathways. Integration of transcriptomic and methylome data identified three genes - GPR68 and FBLIM1 modulated by TGF-β1, and ODF2 responsive to IL-6, as persistently deregulated and demethylated even 4 weeks after treatment termination, a finding that was further confirmed in vitro. Moreover, their significant deregulation in RDEB-tumor tissue compared to RDEB-skin controls suggests that cytokine exposure may induce a stable, pro-tumorigenic shift in RDEB-KCs.
Conclusion:
Overall, our bioinformatic results highlight stable cytokine-driven molecular alterations in RDEB-KCs that may contribute to disease pathogenesis and potentially revealed candidate pathways and genes for future mechanistic and therapeutic investigation.
1 Introduction
Recessive dystrophic epidermolysis bullosa (RDEB) is a rare genodermatosis caused by mutations in the COL7A1 gene. The resulting partial or complete absence or dysfunction of type VII collagen (C7), a key structural component of anchoring fibrils of the dermal-epidermal junction, leads to a particular fragility of skin and mucous membranes, manifesting in skin blistering, impaired wound healing, and excessive fibrosis. Interestingly, RDEB-patients present with a high disease variability, ranging from rather mild and/or localized RDEB variants to severe RDEB subtypes, for which the development of severe complications such as the fusion of digits (referred to as pseudosyndactyly) and the development of particularly aggressive squamous cell carcinomas (SCC) are common (). Even though the type of mutation and the amount of C7 expressed are major determinants of disease severity, this does not always hold true, as there are also patients with identical genetic defects who still exhibit markedly different disease phenotypes (; Jarvikallio et al., 1997; Varki et al., 2007; Pathmarajah et al., 2025). Consequently, this suggests that also other factors affect disease evolvement and progression, which are likely to include epigenetic mechanisms. In this context, a pioneering paradigm was the study of monozygotic RDEB twins, who harboured the same genetic mutation and showed similar C7 expression levels, but significantly diverging phenotypes, with one sibling presenting with a severe form of the disease, whereas the other was classified as mildly affected. In the respective study by Odorisio et al., the role of transforming growth factor-beta (TGF-β1) and Interleukin-6 (IL-6) in influencing disease severity was highlighted, by showing increased cytokine signaling in fibroblasts of the more severely affected twin, going along with differential expression of genes linked to the TGF-β1 pathway (Odorisio et al., 2014). Similar results were achieved in a study of RDEB-siblings with identical mutations but diverging phenotypes, conducted by . Notably, both cytokines, IL-6 and TGF-β, have repeatedly been associated with epidermolysis bullosa (EB) disease severity. For example, serum IL-6 levels were shown to significantly correlate with EB-severity, evaluated using the Birmingham Epidermolysis Bullosa Severity (BEBS) score (; ), and the IL-6/IL-10 ratio was shown to be a potential prognostic EB disease marker (Tampoia et al., 2017).
With regard to potential future clinical implications, studies in murine models, using small molecule drugs (losartan (Nystrom et al., 2015)) or biologics (decorin ()) interfering with TGF-β1 signaling, revealed an amelioration of the mice’ phenotype, represented by a delay in digit fusion and reduced skin fibrosis. Furthermore, in a recent clinical trial evaluating the safety and tolerability of losartan over a 10-month treatment period in RDEB children, the treatment resulted in an improvement of clinical scores (e.g., EBDASI (Jain et al., 2017), as well as an improvement of a score indicative for pseudosyndactyly progression, potentially indicating losartan’s fibrosis-modulating mechanism. However, overall, effects were reported to be moderate and variable in clinical improvement (Kiritsi et al., 2024).
In this study, we were interested in molecular mechanisms associated with long-term exposure of skin cells to the pro-inflammatory cytokines TGF-β1 and IL-6, in order to shed light on potentially irreversible effects that might be associated with limited efficacy of cytokine-targeted therapeutic strategies.
Although fibroblasts are the primary drivers of tissue fibrosis and ECM remodeling in RDEB, we focus on the long-term changes induced by TGF-β1 and IL-6 in keratinocytes (KCs). The significance of epithelial cells in this process has recently gained attention; notably, the epithelial-specific deletion of the TGF-β receptor II protects mice from bleomycin-induced pulmonary fibrosis (Li et al., 2011). Moreover, TGF-β1 can stimulate the expression of fibrogenic factors in normal and malignant epithelial cells, with a process associated with pronounced intratumoral fibrosis (Park et al., 2025; Zhang et al., 2019). In addition, epithelial TGF-β1 responses, through effects like upregulation of integrin αvβ6, inhibition of epithelial cell proliferation, and induction of senescence or cell death, likely worsen fibrosis and hinder tissue regeneration (Sheppard, 2015).
TGF-β1 has been well described in the course of studies to be a stimulator of chronicity both in vitro and in vivo (Liarte et al., 2023; Wang et al., 2006; Katsuno et al., 2019). Here, i.e., a key finding was that long-term exposure of mammary epithelial and cancer cells to TGF-β1 induced stable epithelial-to-mesenchymal transition (EMT) that was not fully reversible upon TGF-β1 withdrawal and the authors raised already the question of a methylation-dependent mechanism underlying this persistence (Katsuno et al., 2019). Indeed, several other studies proved that TGF-β1 lead to long-lasting changes in gene expression, which are in part due to differential methylation events (Negreros et al., 2019; Martin et al., 2014). To date, this aspect, i.e., the long-term cellular effects of TGF-β1, as well as IL-6 in RDEB and the resulting persistent changes on the epigenome and gene expression are relatively unexplored.
To address this gap, in this study, we aimed to elucidate the effects of long-term exposure of RDEB- KCs to TGF-β1 or IL-6 on the transcriptome and methylome, with the goal to gain more insight into pathomechanisms associated with disease severity, and to identify potential biomarkers and drug targets that might mitigate malignant effects of chronic inflammation.
2 Materials and methods
2.1 Cell culture and cytokine treatments
RDEB-KC cell lines were isolated and cultured from tissues derived from patients (n = 3) as described previously (Wimmer et al., 2020; Kocher et al., 2021; ), upon voluntarily given written, informed consent (Table 1).
TABLE 1
| Cell line | Experimental group | Age (yrs) | Sex | COL7A1 mutation | References |
|---|---|---|---|---|---|
| RDEB-57-KC | RDEB-KC | 3 | f | c.427–2A>G/c.4172insC | Wimmer et al. (2020) |
| RDEB-58-KC | RDEB-KC | 0 | f | c.2858-2859delAG, homozygous | Sun et al. (2018) |
| RDEB-223-KC | RDEB-KC | 2 | f | c.425A>G, homozygous | Kocher et al. (2021) |
List of cell lines used in this study.
Ethical approval was granted by the ethics committee of the region of Salzburg (vote number: 415-EP/73/192–2013). Patient KCs were subsequently immortalized by transduction of human papilloma virus proteins E6 and E7 and cultured in defined, serum-free CnT-Prime Epithelial Culture Medium (CELLnTEC, CnT-PR, Bern, Switzerland) at 37 °C with 5% CO2 in a humidified incubator and mycoplasma tested. For cytokine treatments, cells in T75 flasks were stimulated with either 10 ng/mL TGF-β1 (PeproTech, 100–21) or 10 ng/mL IL-6 (R&D, 7270-IL-025/CF) over a period of 4 weeks (T1). After stimulation termination, the cells were cultivated for additional 4 weeks (T2, Figure 1). Appropriate solvent controls (MOCK) for cytokines were cultured in parallel, and once per week all treatment conditions and respective controls were split simultaneously, with the same number of cells reseeded. Cell pellets for DNA and RNA were collected for both timepoints.
FIGURE 1
2.2 DNA isolation and bisulfite conversion
DNA was isolated using the ReliaPrep™ gDNA Miniprep System (Promega, A5081) following the manufacturer’s instructions. A total of 350 ng of genomic DNA was bisulfite-converted using the EZ DNA Methylation-Gold™ Kit (Zymo Research, D5005) following manufacturer’s recommendations, and the converted DNA was eluted in 10 μL M-Elution Buffer.
2.3 DNA methylation profiling and methylome data processing
For the Infinium Methylation EPIC bead chip array (Illumina, 20028878, San Diego, CA, United States), 8 µL of the eluted DNA was loaded and all DNA samples were processed following the Infinium HD Assay Methylation Protocol Guide (15019519 v01). An Illumina NextSeq 550Dx instrument was used for scanning the arrays. Quality control (QC) metrics were generated with Illumina BeadArray Controls Reporter v1.1 Software. QC, data filtering, background correction, and between array quantile normalization were conducted in the statistical software R using the “minfi” Bioconductor package following the recommended workflow outlined by , Maksimovic et al. (2016). In brief, after QC, a data filter step was applied following recommendations in the Maksimovic workflow. Out of 865,859 probes, 37,575 were dropped based on low detection p-value (threshold 1 × 10−10), 74,289 were removed based on association with SNPs, cross-hybridization and gender. 753,995 probes passed QC and filtering were considered for further downstream analysis. The R package “limma” (Ritchie et al., 2015) was used to determine differentially methylated CpGs (DMCs). For determination of significant DMCs, a p-value <0.01 and |fold-change| ≥ 1.5 threshold was applied. DMCs associated with promoter regions (1st Exon, 5′UTR, TSS1500, and TSS200) were further considered for subsequent integration with differentially expressed genes (DEGs).
2.4 RNA isolation and RNA-seq
RNA was extracted using the miRNeasy Tissue/Cells Advanced Mini Kit (Qiagen, 217604, Venlo, Netherlands), according to manufacturer’s recommendations. RNA quality control, polyA enrichment mRNA library preparation (Illumina, NEBnext kit), and sequencing (NovaSeq S1 SR100 flowcell) were outsourced to the Vienna BioCenter.
2.5 Semi-quantitative reverse transcription PCR
Semi-quantitative reverse transcription polymerase chain reaction (sqRT-PCR) was performed using GoTaq® qPCR Master Mix (Promega, TM318, Madison, Wisconsin, United States) according to the manufacturer’s protocol and as described elsewhere (Wimmer et al., 2020). RNA was isolated using the miRNeasy Mini Kit (Qiagen), and reverse transcribed using the iScriptTM cDNA Synthesis Kit (BioRad, 1708890, Hercules, California, United States). SqRT-PCR was performed on a BioRad CFX96 instrument. GAPDH was used as reference, and relative expression and significance levels were calculated using the ΔΔCq method. All experiments were performed in technical triplicates.
The following primers were used:
GAPDH fw: 5′ GCCAACGTGTCAGTGGTGGA 3′, rv: 5′ CACCACCCTGTTGCTGTAGCC 3′; GPR68 fw: 5′ GCCCAGCTGTTTGAGGTTTG 3′, rv: 5′ GTCTGCAGTGATGTTCCCCA 3′; FBLIM1 fw: 5′ AAAATCGAATGCATGGGAAG 3′, rv: 5′ GCAGGTTAGGAAGGGAAACC 3′; ODF2 fw: 5′ GTGTCGCTCCTGGTTTCCAT 3′, rv: 5′ TTCATGGTTGGCTTCTGGCA 3′.
2.6 Transcriptome data processing
Illumina fastq seq data was aligned employing NextFlow “nf-core rnaseq” pipeline using default parameters to generate the raw count matrix. Analysis of the raw count matrix was conducted in R applying the “edgeR.” The edgeR package was employed to determine which genes have sufficiently large counts to be retained in a statistical analysis. After removing low count filtering (edgeR), 32,818 transcripts were considered for downstream analysis. A principal component analysis (PCA) was conducted using R function plot.PCA with top 10,000 genes. Count data were normalized by the method of trimmed mean of M-values (TMM) proposed by Robinson and Oshlack to accommodate for differences in library size using calcNormFactors function in edgeR package (Robinson and Oshlack, 2010). Significantly differentially expressed genes/transcripts (DEGs) were determined using a factorial linear model implemented in the limma-voom framework. For nominating DEGs, a cutoff of p-value <0.01 and |fold-change| ≥ 1.5 was applied.
For GPR68, FBLIM1, and ODF2 expression analysis in RDEB-SCC and RDEB-skin tissue, normalized RNA-seq data generated by Prof. Andy South’s lab (University of Wisconsin-Madison, United States) were retrieved from GEO repository (GEOquery, v2.50.5, GSE111582).
2.7 Pathway analysis and enrichment
To analyse the potential biological relevance of changes in gene expression and methylation, top 100 significantly up- and downregulated top genes, as well as DEGs overlapping with DMCs were used (p < 0.01 and |fold-change| ≥ 1.5) to query Gene Ontologies (GO, Human Phenotype Ontology) and pathway enrichment (Kyoto Encyclopedia of Genes and Genomes (KEGG), using the Enrichr tool (https://maayanlab.cloud/Enrichr/) (Xie et al., 2021).
In addition, enrichment of significant DEGs for individual gene sets associated to pathways with specific relevance to RDEB-pathology were explored based on DEGs filtered by p < 0.01 and |fold-change| ≥ 1.5. The following gene set collections were used: Focal adhesion (KEGG 2021 Human); Skin fibrosis (Elsevier Pathway Collection); Syndactyly MP:0000564 (MGI Mammalian Phenotype Level 42024), Cutaneous Syndactyly HP:0012725 (Human Phenotype Ontology), Impaired/Delayed/Abnormal Wound Healing MP:0001792/MP:0002908/MP:0005023 (MGI Mammalian Phenotype Level 42024), Burn Wound Healing WP5055 (WikiPathways 2024 Human), Regulation of/Wound Healing, Spreading of Epidermal Cells GO:0035313/GO:1903689 (GO Biological Process 2025); Epithelial to Mesenchymal Transition in Cancer: Overview (Elsevier Pathway Collection); p53 signaling pathway (KEGG 2021 Human/BioPlanet 2019); Squamous cell carcinoma HP:0002860 (Human Phenotype Ontology), Squamous cell carcinoma of skin (DisGeNET).
3 Results
3.1 Long-term exposure of RDEB-KCs to TGF-β1 and IL-6 induced global transcriptomic changes
To investigate the impact of long-term exposure of RDEB-KCs to TGF-β1 and IL-6 stimulation on gene expression, we incubated KCs for 4 weeks in the presence or absence of the respective cytokine and performed RNA-seq (Figure 1). PCA of resulting RNA-seq data showed a clear separation of stimuli versus MOCK-treated KCs in dimension 2 (PC2, Figures 2A,B). Next, genes expressed differentially in treated KCs over control were extracted. For TGF-β1, we identified 1,415 significantly upregulated genes and 1,211 downregulated genes upon treatment (Supplementary Table S1; p < 0.01; |fold-change| ≥ 1.5). Of note, in the TGF-β1 group, among the most significantly upregulated genes we found well known TGF-β1 target genes, like “periostin” (POSTN), a potent ECM organizer that has previously been described to be increased in RDEB-fibroblasts and also in the circulation of RDEB patients (), “A Disintegrin And Metalloproteinase Domain 19” (ADAM19), a trans-membrane protein with shedding activity that has frequently been seen overexpressed in fibrotic diseases promoting fibroblast activation (Meng et al., 2024), and “Fibronectin 1” (FN1), a primary component of fibrotic tissue (). Among the most significantly downregulated genes prominent candidates were “Grainyhead Like Transcription Factor 3” (GRHL3), a protein playing important roles in skin homeostasis and wound healing (), and “Sirtuin 5” (SIRT5), a protein being attributed a protective role against fibrosis (Wang et al., 2023; Zullo et al., 2021) (Figure 2C).
FIGURE 2
For IL-6, 864 genes were significantly up-, and 606 downregulated (Supplementary Table S2; p < 0.01; |fold-change| ≥ 1.5). Among the top upregulated genes were relevant players like IL-24, a well-known pro-inflammatory cytokine that modulates epithelial and immune cell responses, e.g., being highly expressed in chronic wounds (; Mitamura et al., 2020), as well as “Piezo Type Mechanosensitive Ion Channel Component 1” (PIEZO1), a mechanosensor in KCs relevant in inflammation, wound healing, scarring and fibrosis (Zhu et al., 2023; Xue et al., 2025). Top IL-6 downregulated genes included “SMAD Family Member 3” (SMAD3), a protein that has been found to have context-dependent tumor suppressive and promotive functions in SCCs and a key regulatory role in IL-6/STAT3 driven fibrosis in systemic sclerosis (; O'Reilly et al., 2014), “gelsolin” (GSN), an actin-binding protein with anti-inflammatory functions, also known to promote wound healing (Wittmann et al., 2018; Witke et al., 1995), and “Laminin Subunit Beta 3” (LAMB3), a component of the laminin-332 trimer, which plays a key role in wound healing and which is known to cause junctional EB if mutated (; Michopoulou et al., 2020) (Figure 2D).
Gene Ontology (GO)-term enrichment analysis revealed that top 100 differentially expressed genes (DEGs, p < 0.01 and |fold-change| ≥ 1.5) upon TGF-β1 treatment significantly affected biological processes like “focal adhesion”, “regulation of actin cytoskeleton” or “VEGF signaling pathway” (Figure 2E). EnrichR analysis of IL-6 induced DEGs highlighted pathways like “ubiquitin mediated proteolysis”, “longevity regulation pathway” or “cell cycle”, as well as ontologies like “cutaneous finger syndactyly”, “2–3 toe syndactyly” or “hypolipoproteinemia” (Figure 2F).
Further exploration of pathways relevant to RDEB-pathology (e.g., regulation of focal adhesion, fibrosis, syndactyly, wound healing, EMT, p53 signaling, and tumor development and/or progression; Figure 3) revealed several of the associated genes to be differentially expressed (p < 0.01; |fold-change| ≥ 1.5) after 4 weeks of treatment (Table 2).
FIGURE 3
TABLE 2
| Pathway | DEGs (T1: TGF-β1) | n (o/t) % | DEGs (T1: IL-6) | n (o/t) % | ||
|---|---|---|---|---|---|---|
| Down | UP | Down | UP | |||
| Focal Adhesion | ACTG1, ACTN4, CAV1, CCND1, CCND2, FLNB, LAMA3, MET, MYL12B, MYLK, PAK1, PAK4, PPP1R12A, PPP1R12B, VAV3 | ACTN1, COL1A1, COL1A2, COL4A1, COL4A2, COL6A2, COL6A3, CTNNB1, FLNB, FLNC, FN1, FYN, ILK, ITGA11, ITGA2, ITGA5, ITGAV, ITGB3, ITGB5, ITGB6, LAMB3, LAMC2, MAP2K1, PARVB, PDGFC, PDGFRA, PIK3CD, PIK3R1, PIP5K1A, PRKCA, PXN, RAC2, SRC, THBS1, THBS3, VEGFA, VEGFC, XIAP | 52/201 25.9% | ACTG1, CCND1, FLNB, LAMB3, MAPK8, PIK3CD, PIK3R1, PTK2, VCL | AKT1, AKT3, CTNNB1, ERBB2, FLNB, FYN, ITGB3, ITGB5, LAMB3, PIK3CD, PIK3R1, THBS3, VEGFA, VEGFC, ZYX | 20/201 10.0% |
| Fibrosis | EDN1, FOS, IL6R, MAP2K4, MAP3K14 | EDNRA, IL6, MAP2K1, MMP1, MMP2, MMP9, PDGFC, PDGFRA, STAT3, TGFB1, TGFBR2, TRAF2, VEGFA | 18/67 26.9% | MAP2K4, MAPK8, SMAD3 | EDNRA, MMP3, TRAF2, VEGFA | 7/67 10.4% |
| Syndactyly | ACTG1, CRIM1, GLI3, GRHL2, IRF6, KRT14, NXN, PVRL4 | ASPH, CCBE1, COL1A1, DCHS1, DLG5, GREM1, LBR, PORCN, SNAI2, TCF7, WNT5A | 19/113 16.8% | ACTG1, APBB2, DKK1, FGFR2, KCTD1, LMBR1, WDR11 | CCBE1, FBN2, KCTD1, LBR, RBM10, WDR19 | 12/113 10.6% |
| Wound Healing | CAV1, CLASP2, DST, FGFR3, HSPB1, IL6R, KLF4, KRT15, LEPR, LGALS7, PHLDB2, PRKCH, S100A9, SDC4, SKP2, SLPI, TGFB2, TP53 | AEBP1, CD44, COL1A1, COL1A2, COL5A1, DYSF, FBN1, FERMT1, FN1, GSN, IL6, INHBA, ITGA5, ITGAV, ITGB3, ITGB5, MMP2, MMP9, RAC2, SDC2, SNAI2, TGFBI, VEGFA | 42/176 23.9% | CDK16, FGFR2, GIPC1, GSN, HSPB1, PLEC, SCEL, SMAD3 | AEBP1, AKT1, CD44, DST, DYSF, GSN, ICAM1, ITGB3, ITGB5, MMP3, SKP2, VEGFA | 19/176 10.8% |
| EMT | CDH1, CLDN1, CRB3, DDR1, DLL1, DSP, IL6R, IRS1, NOTCH3, OCLN | AXL, CDH2, FN1, FOXC2, GLI2, IL6, JAG1, MMP2, MMP9, NOTCH4, PDGFRA, PIK3R1, SERPINE1, SNAI2, SRC, STAT3, VIM | 27/90 30.0% | OCLN, PTK2, PTK2B, VCL | AKT1, ERBB2, HIF1A, PIK3R1 | 8/90 8.9% |
| p53 Signaling | AIFM2, ARID3A, BCL6, BDKRB2, BTG2, CAV1, CCND1, CCND2, CTSD, DGCR8, DUSP1, EDN2, HSPA1B, IGFBP3, JMY, MET, NFYC, PERP, PRDM1, RNF144B, SERPINB5, TP53, TP73, VDR | BCL2L1, CCNE1, MAP4K4, MDM2, MDM4, MMP2, NFYC, PRKAB1, RRM2B, SERPINE1, SHISA5, SNAI2, STEAP3, TFDP1, THBS1, TP53I3, VCAN, ZNF385A | 42/179 23.5% | ARID3A, CCND1, CD82, DKK1, DROSHA, IRF5, MAP4K4, VDR | BBC3, BCL2L1, CD82, MAP4K4, MDM4, PML, PRKAB1, SHISA5, SMARCA4, STEAP3, TFDP1, ZNF385A | 18/179 10.1% |
| Squamous Cell Carcinoma | AQP3, CCND1, GRHL3, KLF4, KRT16, KRT17, MYC, NR3C1, OCLN, PIK3CD, RIPK4, RPS6, S100A8, SERPINB4, SPRR1A, TP53, TP73, TRIM16, TSC1, WNT10A, YAP1 | CARD11, CD44, DAP, EPHB2, ERCC1, FAP, FYN, IL24, IL6, LIMK1, MAP3K9, MMP1, NR3C1, PIK3CD, PLAT, SEC16A, SRC, ST3GAL1, STAT3, TGFB1, TGFBR2, THBS1, TMC6, VEGFA, VEGFC, VIM, XIAP, XPC | 47/214 22.0% | CCND1, GRHL3, LGR6, NR3C1, OCLN, PIK3CD, SPRR1A, STK19, TRIM16, WNT10A | CARD11, CD44, DEF8, ERBB2, FAP, FHL1, FYN, IL24, LIMK1, MAP3K9, NR3C1, PIK3CD, PLAT, SEC16A, SERPINB4, TINF2, TSC1, VEGFA, VEGFC, YAP1 | 28/214 13.1% |
Overview of RDEB-relevant pathways and associated differentially expressed genes (DEGs; p < 0.01; |fold-change| ≥ 1.5) at T1. Number (n) of genes overlapping (o) with total (t) pathway gene list is given as total numbers (n (o/t)) and percentage (%)). Bold and underlined: Genes that remained stably deregulated upon cytokine withdrawal (T2). DEG differentially expressed genes; EMT epithelial-to-mesenchymal transition.
Bold: Genes that remained stably deregulated upon cytokine withdrawal (T2).
3.2 Differentially expressed genes that remain stable beyond treatment
It has previously been shown that long-term TGF-β1 exposure may induce transcriptomic changes that are irreversible, even upon withdrawal of TGF-β1 (Katsuno et al., 2019). In order to explore this phenomenon also in the context of RDEB, we analyzed changes in gene expression that persisted even 4 weeks upon treatment termination (T2). Of the 2,626 DEGs upon TGF-β1 treatment, RNA-seq revealed 220 genes to remain significantly deregulated (Supplementary Table S3), including 133 upregulated and 90 downregulated genes (Figure 4A). Of the 1,470 DEGs upon IL-6 treatment, 193 genes remained to be differentially expressed (Supplementary Table S4), of which 114 were upregulated and 89 downregulated (Figure 4B; p < 0.01; |fold-change| ≥ 1.5).
FIGURE 4
Interestingly, among the persistently deregulated genes we found genes whose functions suggest potential relevance to RDEB-associated complications (e.g., inflammation, wound healing, tumor development), like the “Solute Carrier Family 16 Member 3” (SLC16A3), a monocarboxylate transporter, supporting glycolytic metabolism and associated with poor prognosis in multiple cancers (Sun et al., 2020), or “Mitogen-Activated Protein Kinase Kinase Kinase Kinase 4” (MAP4K4), a kinase involved in systemic inflammation, focal adhesion dynamics and cancer (Singh et al., 2021; Yue et al., 2014). Prominent candidates of TGF-β1-induced persistently downregulated genes were “Itchy E3 Ubiquitin Protein Ligase” (ITCH), a regulator of epidermal keratinocyte differentiation that was also shown to prevent chronic skin inflammation (Rossi et al., 2006; Theivanthiran et al., 2015), and the “SKI Like Proto-Oncogene” (SKIL), a negative regulator of the TGF-β1/SMAD pathway (Tecalco-Cruz et al., 2012) (Figure 4C).
Among the genes that remained upregulated despite IL-6 withdrawal, we found “Heparanase” (HPSE), an enzyme that degrades heparan sulfate in the extracellular matrix (ECM) and basement membrane, thereby having important functions in tissue remodeling, wound healing and inflammatory signaling (Mayfosh et al., 2021), and “Helicase, Lymphoid Specific” (HELLS), a chromatin remodeling protein that interacts with DNA methyltransferases, which was also shown to regulate epidermal homeostasis (Wang et al., 2020). On the other hand, “Ral GTPase Activating Protein Non-Catalytic Subunit Beta” (RALGAPB) involved in oncogenic Ral signaling (Rasche et al., 2025), or “Absent In Melanoma 1 Like” (AIM1L), an actin-binding protein and suppressor of epithelial cell motility and invasion () continued to show strong downregulation (Figure 4D).
To explore the similarities in how each cytokine influences gene expression, we examined the overlap of genes differentially regulated by both TGF-β1 and IL-6, identifying those that are affected by both (Supplementary Figure S1; Supplementary Tables S14, S15).
GO-term enrichment analysis of DEGs that were stably deregulated also after TGF-β1 withdrawal highlighted pathways like “focal adhesion”, “C-type lectin receptor signaling pathway” or “p53 signaling pathway”, and ontologies such as “facial hemangioma” or “postaxial hand polydactyly” (Figure 4E). When investigating DEGs that remained stably deregulated upon IL-6 withdrawal, pathways like the “JAK-STAT signaling pathway”, the “PI3K-Akt signaling pathway”, or “proteoglycans in cancer”, as well as ontologies such as “laryngomalacia”, or “progressive inability to walk” were enriched (Figure 4F).
Furthermore, several of the DEGs at T2 were also associated with the previously analyzed RDEB-relevant pathways (stable DEGs are highlighted in Table 2). It is noteworthy that among all DEGs, genes associated with HDAC1/2/3 signaling were deregulated at both T1 and T2, suggesting a sustained regulatory shift (Supplementary Table S5). As HDAC signaling plays a key role in epigenetic remodeling and chromatin organization, this motivated us to further investigate DNA-methylation dynamics and integrate DNA-methylation with gene-expression data.
3.3 Effect of keratinocyte exposure to TGF-β1 and IL-6 on the methylome
We were interested in TGF-β1 and IL-6 induced differential DNA-methylation in RDEB-KC after 4 weeks of respective cytokine treatments. Out of all detected CpG probes, 0.4% showed a significant differential methylation upon TGF-β1 stimulation, of which 49% were hypermethylated (n = 1,548) and 51% hypomethylated CpGs (n = 1,613) (Figure 5A; Supplementary Table S6). In comparison, IL-6 treatment resulted in 0.3% of differentially methylated CpGs, with 48.8% showing a hypermethylation (n = 1,233) and 51.2% hypomethylation (n = 1,294) (Figure 5B; Supplementary Table S7; p < 0.01; |fold-change| ≥ 1.5). Of those, 4.7% (TGF-β1) and 7.1% (IL-6) were located within the 1st exon, 15% (TGF- β1) and 16.6% (IL-6) within the 5′UTR, 14.7% (TGF-β) and 16.1% (IL-6) within TSS1500, and 8.9% (TGF-β1) and 11.8% (IL-6) within TSS200. The majority of detected DMCs, with 52.3% for TGF-β1 and 43.4% for IL-6, were located within gene body (Figures 5C,D). On the other hand, regarding their distribution relative to CpG island proximity, we observed that a substantial proportion of methylation changes (TGF-β1: 18.4%, IL-6: 28.5%) induced by TGF-β1 or IL-6 were located within CpG islands in addition to such found in open sea regions (TGF-β1: 62.2%, IL-6: 49.6%) (Figures 5E,F). Overall, methylation analyses indicated that the DMCs identified in TGF-β1- and IL-6-treated RDEB-KCs showed a comparable distribution across genomic regions and their relation to CpG island.
FIGURE 5
3.4 Integrated analysis of DNA methylation and gene expression
To elucidate the functional impact of epigenetic regulation, we performed an integrated analysis of DNA methylation and gene expression. Based on the known principle that promoter hypermethylation can restrict transcription factor binding and suppress gene expression, while hypomethylation tends to promote gene activation (Jones, 2012), we focused on inverse (diametral) correlations between methylation changes and gene expression. For this purpose, we restricted our analysis on promoter-associated DMCs (1st Exon, 5′UTR, TSS1500, and TSS200), yielding 854 DMCs in response to TGF-β1 stimulation (Supplementary Table S8) and 910 DMCs in response to IL-6 (Supplementary Table S9). Among the genes upregulated in TGF-β1-stimulated RDEB-KC cells (T1), 50 exhibited corresponding hypomethylated DMCs, while 32 downregulated genes were associated with hypermethylated DMCs (Figure 6A; Supplementary Table S10). Stimulation with IL-6 resulted in 26 upregulated genes associated with hypomethylated DMCs, and 25 downregulated genes linked to hypermethylation (Figure 6B; Supplementary Table S11).
FIGURE 6
Representatives of the top TGF-β1-induced downregulated/hypermethylated genes (Figure 6C) were “B-Cell CLL/Lymphoma 9-Like Protein” (BCL9L), a β-catenin co-activator relevant in tumor progression by regulating WNT- and TGF-β1-signaling (Vafaizadeh et al., 2021) and “Roundabout Guidance Receptor 1” (ROBO1), which is together with SLIT proteins relevant in cell-cell and cell-matrix interactions, as well as tumor progression (). Among the upregulated/hypomethylated genes relevant examples are “FYN Proto-Oncogene” (FYN), a tyrosine kinase that regulates cell adhesion and cytoskeletal dynamics, modulating TGF-β1-driven epithelial responses linked to EMT and fibrosis, including DNA damage related signaling (Veith et al., 2021; Yu et al., 2020), “G Protein-Coupled Receptor 68” (GPR68), a pH-sensing receptor previously been linked to skin cancers, inflammation and epithelial barrier function (Klatt et al., 2020; ; ), and “Prostate transmembrane protein androgen induced 1” (PMEPA1), a well-known TGF-β1 response mediator involved in skin fibrosis, a promoter of EMT and associated with poor survival in several cancers (Wardhani et al., 2021; Watanabe et al., 2019). Moreover, in a study comparing transcriptomes of RDEB-wounds versus non-wounded RDEB-skin, PMEPA1 has also been found to be deregulated (Onoufriadis et al., 2022).
Following IL-6 stimulation, among the top downregulated/hypermethylated genes were “BCL2 Associated Athanogene 6” (BAG6), a chaperone-like protein involved in tumor progression by regulating extracellular vesicle biogenesis (), or “Actin Binding LIM Protein 1” (ABLIM1), an actin binding protein playing a role in cytoskeletal organization that has also been shown to be downregulated in EB-simplex (Liovic et al., 2009). Prominent candidates of the most upregulated/hypomethylated ones were “SEC16A Homolog A” (SEC16A), a scaffold protein required for endoplasmic reticulum export that has been genetically associated with cutaneous SCC risk (), “Forkhead Box P1” (FOXP1), a transcription factor known to get induced by IL-6/STAT3 signaling and having important roles in fibrosis, senescence, wound healing and inflammation (Yang et al., 2025; ), and again “FYN” (Figure 6D, ranked by logFC of DEGs).
GO-term enrichment analysis of diametral DEG/DMC genes upon TGF-β1 stimulation revealed enriched pathways like “Bacterial invasion of epithelial cells”, or “Transcriptional misregulation in cancer”. Additionally, of specific interest were enriched ontologies like “nail dystrophy”, “palmoplantar keratoderma” or “abnormal blistering of the skin” (Figure 6E). Diametral DEG/DMCs following IL-6 stimulation resulted in an enrichment of pathways like “phospholipase D signaling”, “Leukocyte transendothelial migration” or “adherens junctions”, and ontologies such as “preaxial foot polydactyly”, or “decreased number of peripheral myelinated nerve fibers” (Figure 6F).
3.5 Stable gene deregulation and methylation in response to TGF-β1 and IL-6
We next investigated the diametric overlaps between differentially expressed, and differentially methylated genes at T2. Among the 133 TGF-β1 induced stably upregulated genes, two genes–GPR68 and “Filamin Binding LIM Protein 1” (FBLIM1), an adhesion-associated cytoskeletal protein, also mentioned in the context of the EB Kindler-syndrome () – also showed a persistent hypomethylation in T2. In contrast, there was no gene that showed an overlap between downregulated and hypermethylated genes 4 weeks after TGF-β1 withdrawal (Figure 7A; Supplementary Table S12). Among the 114 genes that remained upregulated following IL-6 withdrawal, only one gene also showed persistent hypomethylation at T2, namely, “Outer Dense Fiber Of Sperm Tails 2” (ODF2), whose function in the skin is only sparsely described in the literature. Again, none of the 89 downregulated genes, displayed sustained hypermethylation following IL-6 withdrawal (Figure 7B; Supplementary Table S13). Notably, when comparing the expression of the three consistently deregulated/demethylated genes, along with selected top TGF-β1 and IL-6 induced targets, between primary healthy control (HC) KCs and primary RDEB-KCs, we observed no significant differences, except for SIRT1 (Supplementary Figure S2). To further validate the persistence of the cytokine-induced gene expression changes, we performed sqRT-PCR on the three overlap-genes at both timepoints, T1, representing 4 weeks of cytokine stimulation and T2, after an additional 4-week withdrawal period. Upon TGF-β1 treatment, GPR68 expression was significantly upregulated at T1 and remained significantly elevated at T2, indicating a sustained deregulation even after cytokine removal. FBLIM1 and the IL-6 induced ODF2 showed a similar trend of increased mRNA levels at both timepoints, which, however, did not reach significance (Figures 7C,D). These results suggest that prolonged exposure to TGF-β1 and IL-6 can lead to stable gene expression changes in RDEB-KCs. Interestingly, reanalyzing available tissue data provided by revealed significant deregulation of our selected overlap genes in RDEB tumor tissue compared to normal RDEB skin. Consistent with our RDEB-KC cytokine stimulation data, GPR68, FBLIM1, and ODF2 were significantly elevated in RDEB tumor tissue compared to normal RDEB skin (Figure 7E). Under consideration of their roles in other cancers, they represent potential candidates for future investigations.
FIGURE 7
Overall, our study highlighted that long-term exposure of RDEB-KCs to TGF-β1 or IL-6 induces stable changes in gene expression and DNA methylation. Notably, these persistently differentially expressed and methylated genes are also deregulated in RDEB tumors compared to normal RDEB skin, suggesting a stable phenotypic switch of RDEB-KCs toward a pro-tumorigenic state.
4 Discussion
Chronic inflammation is a key complication in RDEB-patients, shaping RDEB-expressivity significantly. Consequently, several treatment approaches have emerged that target RDEB-associated inflammation in general, or pro-inflammatory cytokines, including TGF-β1 and IL-6 individually (Oleogel-S10, Decorin, diacerein, losartan, unrestricted somatic stem cells (USSC), angiotensin inhibitor, RTA408, or tocilizumab) (Schwieger-Briel et al., 2019;
TGF-β1 and IL-6 are cytokines that play key roles in, e.g., wound healing, tissue fibrosis, shaping of immune responses, and in promoting cell proliferation and differentiation (
When comparing the effects of the two cytokines, TGF-β1 induced a stronger transcriptional response than IL-6 in RDEB-KCs, as shown in the PCAs and total numbers of DEGs at T1 (Figure 2; Supplementary Tables S1, S2). A comparable number of DEGs remained deregulated after withdrawal of the respective cytokine (T2), and both cytokines induced an enrichment of pathways relevant to RDEB. However, TGF-β1 exposure predominantly enriched pathways related to cytoskeletal organization, cell adhesion, EMT and cancer, consistent with its established roles in fibrosis and tumor progression. In contrast, IL-6 primarily promoted pathways associated with inflammation, infection responses, and stress, which is consistent with its role as a pro-inflammatory signaling molecule. Notably, the identified enriched signaling pathways also included those linked to syn- and polydactyly, a relevant finding as pseudosyndactyly is a primary complication in RDEB. In addition, also other RDEB-relevant ontologies were enriched, including “abnormal blistering of the skin”, “nail dystrophy” or “palmar hyperkeratosis”, and also ontologies relating to skeletal and limb abnormalities, underlining the potential role of our experimental cytokines in disease expressivity and progression.
Already evident after 4 weeks of treatment, “focal adhesion” was among the most prominently enriched pathways, with associated DEGs remaining even after treatment withdrawal. Given the role of focal adhesions (FA) in connecting cells to the ECM, this points towards a relevance of FA dysregulation in RDEB wound healing via their impact on cell migration, adhesion and mechanical sensing (Pora et al., 2019; Katoh, 2024). Also, the “p53 signaling” pathway remained enriched upon cytokine withdrawal suggesting a persistent cellular stress response, which in a chronic setting may increase selective pressure for genomic instability and the risk of cancer development (
To shed further light on epigenetic mechanisms associated with TGF-β1 and IL-6 treatments, we screened for DEGs with corresponding diametral methylation events in regions with most relevance to regulation of gene expression. GPR68 and FBLIM1induced by TGF-β1, and ODF2, responsive to IL-6 were identified as genes that stayed both differentially methylated and differentially expressed even after prolonged culturing in the absence of additional cytokine exposure. The pH-sensing receptor GPR68, which is activated by acidic environments, is a recognized regulator of fibrosis in fibroblasts and has also been implicated in promoting EMT and inflammation in epithelial cells (Nagel et al., 2022). However, its specific function within the context of RDEB has not yet been explored. Similarly, the role of ODF2 in the physiology of the skin remains largely unexamined.
FBLIM1 is important for cell adhesion and maintaining cytoskeletal stability and has been previously identified as a binding partner of kindlin-1 in the context of Kindler syndrome. Despite this association, FBLIM1 expression is not dependent on kindlin-1, and FBLIM1 knockout mice exhibit a normal phenotype with intact skin (Moik et al., 2011; Lai-Cheong et al., 2008). More recent research has revealed a novel function for FBLIM1 as a key regulator of autophagy, a process through which it may also promote cancer progression (
Overall, this study provides a data-driven look at the methylome and transcriptome response of in vitro-stimulated KCs, with a particular focus on long-term effects of RDEB-KC exposure to pro-inflammatory cytokines TGF-β1 and IL-6. Bioinformatic data analysis revealed that distinct pathways appeared to be altered long-term, even in the absence of any further cytokine stimuli. Integrating our transcriptome and methylome data highlighted distinct genes to be permanently deregulated, which we could confirm in vitro. Notably, these biomarkers also showed a significantly altered expression in RDEB-tumor tissue compared to RDEB-skin, potentially suggesting a stable pro-tumorigenic switch of the RDEB-KCs upon cytokine exposure.
In conclusion, with this primarily bioinformatic analysis, we provide novel insights into the impact of long-term exposure of RDEB-KC to cytokines that have previously been described to correlate with RDEB disease severity. Further studies are necessary to determine the relevance of our findings on a potential drug candidate’s mechanism of action, and to assess whether and how long-term deregulation of specific genes may impact treatment outcomes.
Statements
Data availability statement
Raw transcriptome and genome-wide methylome sequencing data are not available to protect patient privacy; anonymized data will be made available upon reasonable request. The authors declare that all other data are contained within the manuscript and Supplementary Materials.
Ethics statement
The studies involving humans were approved by RDEB tissue samples collected in Salzburg were obtained from patients undergoing dermatological surgery upon written, informed consent. Ethical approval was granted by the ethics committee of the county of Salzburg (vote number: 415-EP/73/192–2013) for RDEB cell isolations. The studies were conducted in accordance with the local legislation and institutional requirements. Written informed consent for participation in this study was provided by the participants’ legal guardians/next of kin.
Author contributions
JH: Conceptualization, Data curation, Formal Analysis, Investigation, Methodology, Validation, Visualization, Writing – original draft, Writing – review and editing. RZ: Conceptualization, Data curation, Formal Analysis, Investigation, Methodology, Software, Validation, Visualization, Writing – review and editing. SG: Investigation, Validation, Visualization, Writing – review and editing. SD: Investigation, Writing – review and editing. MA: Investigation, Writing – review and editing. VW: Investigation, Writing – review and editing. CB: Investigation, Writing – review and editing. ML: Writing – review and editing. CG-G: Writing – review and editing. JP: Funding acquisition, Writing – review and editing. UK: Funding acquisition, Writing – review and editing. JB: Supervision, Writing – review and editing. VW: Conceptualization, Data curation, Formal Analysis, Funding acquisition, Investigation, Methodology, Project administration, Resources, Supervision, Validation, Visualization, Writing – original draft, Writing – review and editing.
Funding
The author(s) declared that financial support was received for this work and/or its publication. This project was supported by the Austrian Science Fund (FWF): I4754-B, The Paracelsus Medical University Salzburg (PMU-RIF 2021-UP-001-Wally) and DEBRA Austria.
Acknowledgments
We would like to thank Professor Karl Sotlar, Associate Professor Theo Kraus and Barbara Zellinger, Institute of Pathology, University Hospital Salzburg, for supporting us with the NextSeq equipment.
Conflict of interest
The author(s) declared that this work was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
Generative AI statement
The author(s) declared that generative AI was used in the creation of this manuscript. We used ChatGPT (OpenAI, GPT-5-model, version December 2025) for language editing assistance. The tool was used exclusively to improve clarity, grammar, and phrasing, and all content was manually reviewed and verified by the authors. This work is generated within the ERN skin.
Any alternative text (alt text) provided alongside figures in this article has been generated by Frontiers with the support of artificial intelligence and reasonable efforts have been made to ensure accuracy, including review by the authors wherever possible. If you identify any issues, please contact us.
Publisher’s note
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.
Supplementary material
The Supplementary Material for this article can be found online at: https://www.frontiersin.org/articles/10.3389/fcell.2026.1810599/full#supplementary-material
Glossary
- ABLIM1
Actin Binding LIM Protein 1
- ADAM19
A Disintegrin And Metalloproteinase Domain 19
- AIM1L
Absent In Melanoma 1 Like
- BAG6
BCL2 Associated Athanogene 6
- BCL9L
B-Cell CLL/Lymphoma 9 Like
- C7
Type VII Collagen
- DEG
Differentially Expressed Gene(s)
- DMC
Differentially Methylated CpG(s)
- EB
Epidermolysis Bullosa
- ECM
Extracellular Matrix
- EMT
Epithelial-to-Mesenchymal Transition
- FBLIM1
Filamin Binding LIM Protein 1
- FN1
Fibronectin 1
- FOXP1
Forkhead Box P1
- FYN
FYN Proto-Oncogene
- GO
Gene Ontology
- GPR68
G Protein-Coupled Receptor 68
- GRHL3
Grainyhead Like Transcription Factor 3
- GSN
Gelsolin
- HELLS
Helicase, Lymphoid Specific
- HPSE
Heparanase
- IL-6
Interleukin-6
- ITCH
Itchy E3 Ubiquitin Protein Ligase
- KC
Keratinocyte
- KEGG
Kyoto Encyclopedia of Genes and Genomes
- LAMB3
Laminin Subunit Beta 3
- MAP4K4
Mitogen-Activated Protein Kinase Kinase Kinase Kinase 4
- ODF2
Outer Dense Fiber of Sperm Tails 2
- PCA
Principal Component Analysis
- PIEZO1
Piezo Type Mechanosensitive Ion Channel Component 1
- PMEPA1
Prostate Transmembrane Protein, Androgen Induced 1
- POSTN
Periostin
- QC
Quality control
- RALGAPB
Ral GTPase Activating Protein Beta Subunit
- RDEB
Recessive Dystrophic Epidermolysis Bullosa
- ROBO1
Roundabout Guidance Receptor 1
- SCC
Squamous Cell Carcinoma
- SEC16A
SEC16 Homolog A
- SIRT5
Sirtuin 5
- SKIL
SKI Like Proto-Oncogene
- SLC16A3
Solute Carrier Family 16 Member 3
- SMAD3
SMAD Family Member 3
- sqRT-PCR
Semi-quantitative Reverse Transcription Polymerase Chain Reaction
- TGF-β1
Transforming Growth Factor Beta 1
- USSC
Unrestricted Somatic Stem Cell
References
1
AbuetabhY.WuH. H.ChaiC.Al YousefH.PersadS.SergiC. M.et al (2022). DNA damage response revisited: the p53 family and its regulators provide endless cancer therapy opportunities. Exp. Mol. Med.54, 1658–1669. 10.1038/s12276-022-00863-4
2
AkasakaE.KleiserS.SengleG.Bruckner-TudermanL.NystromA. (2021). Diversity of mechanisms underlying latent TGF-Beta activation in recessive dystrophic epidermolysis bullosa. J. Investig. Dermatol141, 1450–1460 e9. 10.1016/j.jid.2020.10.024
3
Alashkar AlhamweB.PonathV.AlhamdanF.DorsamB.LandwehrC.LinderM.et al (2024). BAG6 restricts pancreatic cancer progression by suppressing the release of IL33-presenting extracellular vesicles and the activation of mast cells. Cell. Mol. Immunol.21, 918–931. 10.1038/s41423-024-01195-1
4
Anderson-CrannageM.AscensionA. M.Ibanez-SoleO.ZhuH.SchaeferE.OttomanelliD.et al (2023). Inflammation-mediated fibroblast activation and immune dysregulation in collagen VII-Deficient skin. Front. Immunol.14, 1211505. 10.3389/fimmu.2023.1211505
5
Anderson-CrannageM.NystromA.HiraniR.SchaeferE.HochbergB.KannR.et al (2025). Inflammatory modulation by cord blood stem cells prevented digit deformation in recessive dystrophic epidermolysis bullosa. Mol. Ther.33, 5427–5441. 10.1016/j.ymthe.2025.08.038
6
AnnicchiaricoG.MorgeseM. G.EspositoS.LopalcoG.LattaruloM.TampoiaM.et al (2015). Proinflammatory cytokines and antiskin autoantibodies in patients with inherited epidermolysis bullosa. Med. Baltim.94, e1528. 10.1097/MD.0000000000001528
7
AryeeM. J.JaffeA. E.Corrada-BravoH.Ladd-AcostaC.FeinbergA. P.HansenK. D.et al (2014). Minfi: a flexible and comprehensive bioconductor package for the analysis of infinium DNA methylation microarrays. Bioinformatics30, 1363–1369. 10.1093/bioinformatics/btu049
8
BosanquetD. C.HardingK. G.RugeF.SandersA. J.JiangW. G. (2012). Expression of IL-24 and IL-24 receptors in human wound tissues and the biological implications of IL-24 on keratinocytes. Wound Repair Regen.20, 896–903. 10.1111/j.1524-475X.2012.00840.x
9
CaiR.BaiP.QuanM.DingY.WeiW.LiuC.et al (2024). Migfilin promotes autophagic flux through direct interaction with SNAP29 and Vamp8. J. Cell. Biol.223, e202312119. 10.1083/jcb.202312119
10
Chacon-SolanoE.LeonC.DiazF.Garcia-GarciaF.GarciaM.EscamezM. J.et al (2019). Fibroblast activation and abnormal extracellular matrix remodelling as common hallmarks in three cancer-prone genodermatoses. Br. J. Dermatol181, 512–522. 10.1111/bjd.17698
11
Chacon-SolanoE.LeonC.CarreteroM.GarciaM.Sanchez-DominguezR.QueroF.et al (2022). Mechanistic interrogation of mutation-independent disease modulators of RDEB identifies the small leucine-rich proteoglycan PRELP as a TGF-Beta antagonist and inhibitor of fibrosis. Matrix Biol.111, 189–206. 10.1016/j.matbio.2022.06.007
12
ChahalH. S.LinY.RansohoffK. J.HindsD. A.WuW.DaiH. J.et al (2016). Genome-wide association study identifies novel susceptibility loci for cutaneous squamous cell carcinoma. Nat. Commun.7, 12048. 10.1038/ncomms12048
13
ChoR. J.AlexandrovL. B.Den BreemsN. Y.AtanasovaV. S.FarshchianM.PurdomE.et al (2018). APOBEC mutation drives early-onset squamous cell carcinomas in recessive dystrophic epidermolysis bullosa. Sci. Transl. Med.10. 10.1126/scitranslmed.aas9668
14
ChristofidouE. D.TomazouM.VoutouriC.MichaelC.StylianopoulosT.SpyrouG. M.et al (2024). Oct4 is a gatekeeper of epithelial identity by regulating cytoskeletal organization in skin keratinocytes. Cell. Rep.43, 113859. 10.1016/j.celrep.2024.113859
15
CianfaraniF.De DomenicoE.NystromA.MastroeniS.AbeniD.BaldiniE.et al (2019). Decorin counteracts disease progression in mice with recessive dystrophic epidermolysis bullosa. Matrix Biol.81, 3–16. 10.1016/j.matbio.2018.12.001
16
Cohen-NowakA. J.CohenA. J.CorreiaE. D.PortocarreroC. P.SouthA. P.NikbakhtN. (2022). Omaveloxolone attenuates squamous cell carcinoma growth and disease severity in an epidermolysis bullosa mouse model. Exp. Dermatol31, 1083–1088. 10.1111/exd.14564
17
CondorelliA. G.DellambraE.LogliE.ZambrunoG.CastigliaD. (2019). Epidermolysis bullosa-associated squamous cell carcinoma: from pathogenesis to therapeutic perspectives. Int. J. Mol. Sci.20. 10.3390/ijms20225707
18
DaskalakiM. G.LapiI.HurstA. E.Al-QahtaniA.VergadiE.TsatsanisC. (2025). Epigenetic and metabolic regulation of macrophage responsiveness and memory. J. Immunol.214, 2812–2821. 10.1093/jimmun/vkaf135
19
De GregorioC.CatalanE.GarridoG.MorandeP.BennettJ. C.MunozC.et al (2023). Maintenance of chronicity signatures in fibroblasts isolated from recessive dystrophic epidermolysis bullosa chronic wound dressings under culture conditions. Biol. Res.56, 23. 10.1186/s40659-023-00437-2
20
De ValliereC.VidalS.ClayI.JurisicG.TcymbarevichI.LangS.et al (2015). The pH-sensing receptor OGR1 improves barrier function of epithelial cells and inhibits migration in an acidic environment. Am. J. Physiol. Gastrointest. Liver Physiol.309, G475–G490. 10.1152/ajpgi.00408.2014
21
De ValliereC.Cosin-RogerJ.BaeblerK.SchoepflinA.MamieC.MolletM.et al (2022). pH-Sensing G protein-coupled receptor OGR1 (GPR68) expression and activation increases in intestinal inflammation and fibrosis. Int. J. Mol. Sci.23, 1419. 10.3390/ijms23031419
22
DengZ.FanT.XiaoC.TianH.ZhengY.LiC.et al (2024). TGF-Beta signaling in health, disease, and therapeutics. Signal Transduct. Target Ther.9, 61. 10.1038/s41392-024-01764-w
23
DorferS.AblingerM.WimmerM.HummelJ. I.IbrahimpasicS.DiemA.et al (2025). Repurposing diacerein for the treatment of chronic wounds in recessive-dystrophic epidermolysis bullosa patients by modulating matrix metalloproteinase-9 expression. J. Dermatol52, 423–431. 10.1111/1346-8138.17621
24
EspositoS.GuezS.OrentiA.TadiniG.ScuveraG.CortiL.et al (2016). Autoimmunity and cytokine imbalance in inherited epidermolysis bullosa. Int. J. Mol. Sci.17. 10.3390/ijms17101625
25
GordonW. M.ZellerM. D.KleinR. H.SwindellW. R.HoH.EspetiaF.et al (2014). A GRHL3-regulated repair pathway suppresses immune-mediated epidermal hyperplasia. J. Clin. Investig.124, 5205–5218. 10.1172/JCI77138
26
GrebenciucovaE.VanhaerentsS. (2023). Interleukin 6: at the interface of human health and disease. Front. Immunol.14, 1255533. 10.3389/fimmu.2023.1255533
27
GriggsL. A.HassanN. T.MalikR. S.GriffinB. P.MartinezB. A.ElmoreL. W.et al (2017). Fibronectin fibrils regulate TGF-beta1-induced epithelial-mesenchymal transition. Matrix Biol.60-61, 157–175. 10.1016/j.matbio.2017.01.001
28
GudkovA. V.KomarovaE. A. (2016). p53 and the carcinogenicity of chronic inflammation. Cold Spring Harb. Perspect. Med.6. 10.1101/cshperspect.a026161
29
HaffnerM. C.EsopiD. M.ChauxA.GurelM.GhoshS.VaghasiaA. M.et al (2017). AIM1 is an actin-binding protein that suppresses cell migration and micrometastatic dissemination. Nat. Commun.8, 142. 10.1038/s41467-017-00084-8
30
HanG.WangX. J. (2011). Roles of TGFbeta signaling smads in squamous cell carcinoma. Cell. Biosci.1, 41. 10.1186/2045-3701-1-41
31
HasC.HerzC.ZiminaE.QuH. Y.HeY.ZhangZ. G.et al (2009). Kindlin-1 is required for RhoGTPase-mediated lamellipodia formation in keratinocytes. Am. J. Pathol.175, 1442–1452. 10.2353/ajpath.2009.090203
32
HasC.BauerJ. W.BodemerC.BollingM. C.Bruckner-TudermanL.DiemA.et al (2020). Consensus reclassification of inherited epidermolysis bullosa and other disorders with skin fragility. Br. J. Dermatol183, 614–627. 10.1111/bjd.18921
33
HochmannS.MittermeirM.SanticR.KoszikF.GriessnerL.SondereggerA. S.et al (2018). Evaluation of modified interferon alpha mRNA constructs for the treatment of non-melanoma skin cancer. Sci. Rep.8, 12954. 10.1038/s41598-018-31061-w
34
HuJ.LiuX.TangY. (2022). HMGB1/Foxp1 regulates hypoxia-induced inflammatory response in macrophages. Cell. Biol. Int.46, 265–277. 10.1002/cbin.11728
35
IllmerJ.ZaunerR.Pinon HofbauerJ.WimmerM.GrunerS.AblingerM.et al (2023). MicroRNA-200b-mediated reversion of a spectrum of epithelial-to-mesenchymal transition states in recessive dystrophic epidermolysis bullosa squamous cell carcinomas. Br. J. Dermatol190, 80–93. 10.1093/bjd/ljad335
36
JainS. V.HarrisA. G.SuJ. C.OrchardD.WarrenL. J.McmanusH.et al (2017). The epidermolysis bullosa disease activity and scarring index (EBDASI): grading disease severity and assessing responsiveness to clinical change in epidermolysis bullosa. J. Eur. Acad. Dermatol Venereol.31, 692–698. 10.1111/jdv.13953
37
JarvikallioA.PulkkinenL.UittoJ. (1997). Molecular basis of dystrophic epidermolysis bullosa: mutations in the type VII collagen gene (COL7A1). Hum. Mutat.10, 338–347. 10.1002/(SICI)1098-1004(1997)10:5<338::AID-HUMU2>3.0.CO;2-B
38
JonesP. A. (2012). Functions of DNA methylation: islands, start sites, gene bodies and beyond. Nat. Rev. Genet.13, 484–492. 10.1038/nrg3230
39
JosephJ.MurrayA.TruongK.TatianA. (2025). Safety and efficacy of angiotensin receptor antagonists in recessive dystrophic epidermolysis bullosa. Australas. J. Dermatol66, e414–e419. 10.1111/ajd.14594
40
KatohK. (2024). Signal transduction mechanisms of focal adhesions: src and FAK-mediated cell response. Front. Biosci. Landmark Ed.29, 392. 10.31083/j.fbl2911392
41
KatsunoY.MeyerD. S.ZhangZ.ShokatK. M.AkhurstR. J.MiyazonoK.et al (2019). Chronic TGF-Beta exposure drives stabilized EMT, tumor stemness, and cancer drug resistance with vulnerability to bitopic mTOR inhibition. Sci. Signal12. 10.1126/scisignal.aau8544
42
KiritsiD.SchauerF.GewertS.ReinekerK.Reimer-TaschenbreckerA.Schwieger-BrielA.et al (2024). Safety and tolerability of losartan to treat recessive dystrophic epidermolysis bullosa in children (REFLECT): an open-label, single-arm, phase 1/2 trial. EClinicalMedicine77, 102900. 10.1016/j.eclinm.2024.102900
43
KlattW.WallnerS.BrochhausenC.StolwijkJ. A.SchremlS. (2020). Expression profiles of proton-sensing G-protein coupled receptors in common skin tumors. Sci. Rep.10, 15327. 10.1038/s41598-020-71700-9
44
KocherT.BischofJ.HaasS. A.MarchO. P.LiembergerB.HainzlS.et al (2021). A non-viral and selection-free COL7A1 HDR approach with improved safety profile for dystrophic epidermolysis bullosa. Mol. Ther. Nucleic Acids25, 237–250. 10.1016/j.omtn.2021.05.015
45
Lai-CheongJ. E.UssarS.AritaK.HartI. R.McgrathJ. A. (2008). Colocalization of kindlin-1, kindlin-2, and migfilin at keratinocyte focal adhesion and relevance to the pathophysiology of kindler syndrome. J. Investig. Dermatol128, 2156–2165. 10.1038/jid.2008.58
46
LaxS. J.Van VogtE.CandyB.SteeleL.ReynoldsC.StuartB.et al (2024). Topical anti-inflammatory treatments for eczema: a cochrane systematic review and network meta-analysis. Clin. Exp. Allergy54, 960–972. 10.1111/cea.14556
47
LeeC. A. A.WuS.ChowY. T.KofmanE.WilliamsV.RiddleM.et al (2024). Accelerated aging and microsatellite instability in recessive dystrophic epidermolysis bullosa-associated cutaneous squamous cell carcinoma. J. Investig. Dermatol144, 1534–1543 e2. 10.1016/j.jid.2023.11.025
48
LiM.KrishnaveniM. S.LiC.ZhouB.XingY.BanfalviA.et al (2011). Epithelium-specific deletion of TGF-Beta receptor type II protects mice from bleomycin-induced pulmonary fibrosis. J. Clin. Investig.121, 277–287. 10.1172/JCI42090
49
LiarteS.Bernabe-GarciaA.NicolasF. J. (2020). Role of TGF-Beta in skin chronic wounds: a keratinocyte perspective. Cells9. 10.3390/cells9020306
50
LiarteS.Bernabe-GarciaA.Rodriguez-ValienteM.MoraledaJ. M.CastellanosG.NicolasF. J. (2023). Amniotic membrane restores chronic wound features to normal in a keratinocyte TGF-beta-Chronified cell model. Int. J. Mol. Sci.24. 10.3390/ijms24076210
51
LiovicM.D'AlessandroM.Tomic-CanicM.BolshakovV. N.CoatsS. E.LaneE. B. (2009). Severe keratin 5 and 14 mutations induce down-regulation of junction proteins in keratinocytes. Exp. Cell. Res.315, 2995–3003. 10.1016/j.yexcr.2009.07.013
52
MaksimovicJ.PhipsonB.OshlackA. (2016). A cross-package bioconductor workflow for analysing methylation array data. F1000Res5, 1281. 10.12688/f1000research.8839.1
53
MartinM.AnceyP. B.CrosM. P.DurandG.Le Calvez-KelmF.Hernandez-VargasH.et al (2014). Dynamic imbalance between cancer cell subpopulations induced by transforming growth factor beta (TGF-beta) is associated with a DNA methylome switch. BMC Genomics15, 435. 10.1186/1471-2164-15-435
54
MassagueJ.SheppardD. (2023). TGF-Beta signaling in health and disease. Cell.186, 4007–4037. 10.1016/j.cell.2023.07.036
55
MayfoshA. J.NguyenT. K.HulettM. D. (2021). The heparanase regulatory network in health and disease. Int. J. Mol. Sci.22, 11096. 10.3390/ijms222011096
56
MengQ.BaoD.LiuS.HuangJ.GuoM.DaiB.et al (2024). ADAM metallopeptidase domain 19 promotes skin fibrosis in systemic sclerosis via neuregulin-1. Mol. Med.30, 269. 10.1186/s10020-024-01047-8
57
MichopoulouA.MontmassonM.GarnierC.LambertE.DayanG.RousselleP. (2020). A novel mechanism in wound healing: laminin 332 drives MMP9/14 activity by recruiting syndecan-1 and CD44. Matrix Biol.94, 1–17. 10.1016/j.matbio.2020.06.004
58
MitamuraY.NunomuraS.FurueM.IzuharaK. (2020). IL-24: a new player in the pathogenesis of pro-inflammatory and allergic skin diseases. Allergol. Int.69, 405–411. 10.1016/j.alit.2019.12.003
59
MoikD. V.JanbandhuV. C.FasslerR. (2011). Loss of migfilin expression has no overt consequences on murine development and homeostasis. J. Cell. Sci.124, 414–421. 10.1242/jcs.075960
60
NagelD. J.RackowA. R.KuW. Y.BellT. J.SimeP. J.KottmannR. M. (2022). Cell-type-specific effects of the ovarian cancer G-Protein coupled receptor (OGR1) on inflammation and fibrosis; potential implications for idiopathic pulmonary fibrosis. Cells11, 2540. 10.3390/cells11162540
61
NaruseS.TakashimaS.FujitaY.KataokaH.KawamuraN.NatsugaK.et al (2024). Successful treatment of multicentric Castleman's disease associated with dystrophic epidermolysis bullosa using anti-interleukin-6 receptor antibody. J. Dermatol51, e268–e269. 10.1111/1346-8138.17172
62
NegrerosM.HagoodJ. S.EspinozaC. R.Balderas-MartinezY. I.SelmanM.PardoA. (2019). Transforming growth factor beta 1 induces methylation changes in lung fibroblasts. PLoS One14, e0223512. 10.1371/journal.pone.0223512
63
NystromA.ThrieneK.MittapalliV.KernJ. S.KiritsiD.DengjelJ.et al (2015). Losartan ameliorates dystrophic epidermolysis bullosa and uncovers new disease mechanisms. EMBO Mol. Med.7, 1211–1228. 10.15252/emmm.201505061
64
O'ReillyS.CiechomskaM.CantR.Van LaarJ. M. (2014). Interleukin-6 (IL-6) trans signaling drives a STAT3-dependent pathway that leads to hyperactive transforming growth factor-beta (TGF-beta) signaling promoting SMAD3 activation and fibrosis via gremlin protein. J. Biol. Chem.289, 9952–9960. 10.1074/jbc.M113.545822
65
OdorisioT.Di SalvioM.OrecchiaA.Di ZenzoG.PiccinniE.CianfaraniF.et al (2014). Monozygotic twins discordant for recessive dystrophic epidermolysis bullosa phenotype highlight the role of TGF-Beta signalling in modifying disease severity. Hum. Mol. Genet.23, 3907–3922. 10.1093/hmg/ddu102
66
OnoufriadisA.ProudfootL. E.AinaliC.TorreD.PapanikolaouM.RayindaT.et al (2022). Transcriptomic profiling of recessive dystrophic epidermolysis bullosa wounded skin highlights drug repurposing opportunities to improve wound healing. Exp. Dermatol31, 420–426. 10.1111/exd.14481
67
ParkH. J.ShinJ.SarkerA.KlangM. G.RiedelE.CoriddiM.et al (2025). TGF-beta-mediated epithelial-mesenchymal transition of keratinocytes promotes fibrosis in secondary lymphedema. JCI Insight10. 10.1172/jci.insight.192890
68
PathmarajahP.EidE.NazaroffJ.SoJ.MittalV.HarrisN.et al (2025). Functional genotype classification groups distinguish disease severity in recessive dystrophic epidermolysis bullosa. Br. J. Dermatol192, 917–925. 10.1093/bjd/ljaf015
69
PoraA.YoonS.WindofferR.LeubeR. E. (2019). Hemidesmosomes and focal adhesions treadmill as separate but linked entities during keratinocyte migration. J. Investig. Dermatol139, 1876–1888 e4. 10.1016/j.jid.2019.03.1139
70
RascheR.KlinkB. U.ApkenL. H.MichalkeE.ChenM.OeckinghausA.et al (2025). Structure and mechanism of the RalGAP tumor suppressor complex. Nat. Commun.16, 7002. 10.1038/s41467-025-61743-9
71
RitchieM. E.PhipsonB.WuD.HuY.LawC. W.ShiW.et al (2015). Limma powers differential expression analyses for RNA-Sequencing and microarray studies. Nucleic Acids Res.43, e47. 10.1093/nar/gkv007
72
RobinsonM. D.OshlackA. (2010). A scaling normalization method for differential expression analysis of RNA-Seq data. Genome Biol.11, R25. 10.1186/gb-2010-11-3-r25
73
RossiM.AqeilanR. I.NealeM.CandiE.SalomoniP.KnightR. A.et al (2006). The E3 ubiquitin ligase itch controls the protein stability of p63. Proc. Natl. Acad. Sci. U. S. A.103, 12753–12758. 10.1073/pnas.0603449103
74
SadidaH. Q.AbdullaA.MarzooqiS. A.HashemS.MachaM. A.AkilA. S. A.et al (2024). Epigenetic modifications: key players in cancer heterogeneity and drug resistance. Transl. Oncol.39, 101821. 10.1016/j.tranon.2023.101821
75
Schwieger-BrielA.OttH.KiritsiD.Laszczyk-LauerM.BodemerC. (2019). Mechanism of Oleogel-S10: a triterpene preparation for the treatment of epidermolysis bullosa. Dermatol Ther.32, e12983. 10.1111/dth.12983
76
SheppardD. (2015). Epithelial-mesenchymal interactions in fibrosis and repair. Transforming growth factor-beta activation by epithelial cells and fibroblasts. Ann. Am. Thorac. Soc.12 (Suppl. 1), S21–S23. 10.1513/AnnalsATS.201406-245MG
77
SinghS. K.KumarS.ViswakarmaN.PrincipeD. R.DasS.SondarvaG.et al (2021). MAP4K4 promotes pancreatic tumorigenesis via phosphorylation and activation of mixed lineage kinase 3. Oncogene40, 6153–6165. 10.1038/s41388-021-02007-w
78
SinghK.RustagiY.AbouhashemA. S.TabasumS.VermaP.HernandezE.et al (2022). Genome-wide DNA hypermethylation opposes healing in patients with chronic wounds by impairing epithelial-mesenchymal transition. J. Clin. Investig.132, e157279. 10.1172/JCI157279
79
SunY.WoessK.KienzlM.Leb-ReichlV. M.FeinleA.WimmerM.et al (2018). Extracellular vesicles as biomarkers for the detection of a tumor marker gene in epidermolysis bullosa-associated squamous cell carcinoma. J. Investig. Dermatol138, 1197–1200. 10.1016/j.jid.2017.11.022
80
SunX.WangM.WangM.YaoL.LiX.DongH.et al (2020). Role of proton-coupled monocarboxylate transporters in cancer: from metabolic crosstalk to therapeutic potential. Front. Cell. Dev. Biol.8, 651. 10.3389/fcell.2020.00651
81
TampoiaM.AbbracciaventoL.MorroneM.FumaruloR. (2017). IL-6/IL-10 ratio as A prognostic and predictive marker of the severity of inherited epidermolysis Bullosa. Iran. J. Immunol.14, 340–349.
82
Tecalco-CruzA. C.Sosa-GarrochoM.Vazquez-VictorioG.Ortiz-GarciaL.Dominguez-HuttingerE.Macias-SilvaM. (2012). Transforming growth factor-beta/SMAD Target gene SKIL is negatively regulated by the transcriptional cofactor complex SNON-SMAD4. J. Biol. Chem.287, 26764–26776. 10.1074/jbc.M112.386599
83
TengJ.PallerA. S.BrucknerA. L.MurrellD. F.MellerioJ. E.BodemerC.et al (2023). Diacerein 1% ointment for the treatment of epidermolysis bullosa simplex: a randomized, controlled trial. J. Drugs Dermatol22, 599–604. 10.36849/JDD.7108
84
TheivanthiranB.KathaniaM.ZengM.AnguianoE.BasrurV.VandergriffT.et al (2015). The E3 ubiquitin ligase itch inhibits p38alpha signaling and skin inflammation through the ubiquitylation of Tab1. Sci. Signal8, ra22. 10.1126/scisignal.2005903
85
TsoiL. C.PatrickM. T.ShuaiS.SarkarM. K.ChiS.RuffinoB.et al (2022). Cytokine responses in nonlesional psoriatic skin as clinical predictor to anti-TNF agents. J. Allergy Clin. Immunol.149, 640–649 e5. 10.1016/j.jaci.2021.07.024
86
VafaizadehV.BuechelD.RubinsteinN.KalathurR. K. R.BazzaniL.SaxenaM.et al (2021). The interactions of Bcl9/Bcl9L with beta-catenin and pygopus promote breast cancer growth, invasion, and metastasis. Oncogene40, 6195–6209. 10.1038/s41388-021-02016-9
87
VarkiR.SadowskiS.UittoJ.PfendnerE. (2007). Epidermolysis bullosa. II. Type VII collagen mutations and phenotype-genotype correlations in the dystrophic subtypes. J. Med. Genet.44, 181–192. 10.1136/jmg.2006.045302
88
VeithC.HristovaM.DanyalK.HabibovicA.DustinC. M.McdonoughJ. E.et al (2021). Profibrotic epithelial TGF-beta1 signaling involves NOX4-mitochondria cross talk and redox-mediated activation of the tyrosine kinase FYN. Am. J. Physiol. Lung Cell. Mol. Physiol.320, L356–L367. 10.1152/ajplung.00444.2019
89
WangX. J.HanG.OwensP.SiddiquiY.LiA. G. (2006). Role of TGF beta-mediated inflammation in cutaneous wound healing. J. Investig. Dermatol Symp. Proc.11, 112–117. 10.1038/sj.jidsymp.5650004
90
WangS.DrummondM. L.Guerrero-JuarezC. F.TaraporeE.MacleanA. L.StabellA. R.et al (2020). Single cell transcriptomics of human epidermis identifies basal stem cell transition states. Nat. Commun.11, 4239. 10.1038/s41467-020-18075-7
91
WangC.HeD.ShiC. (2023). SIRT5 reduces the inflammatory response and barrier dysfunction in IL-17A-induced epidermal keratinocytes. Allergol. Immunopathol. Madr.51, 30–36. 10.15586/aei.v51i1.675
92
WardhaniB. W. K.LouisaM.WatanabeY.SetiabudyR.KatoM. (2021). TGF-beta-Induced TMEPAI promotes epithelial-mesenchymal transition in doxorubicin-treated triple-negative breast cancer cells via SMAD3 and PI3K/AKT pathway alteration. Breast Cancer (Dove Med. Press)13, 529–538. 10.2147/BCTT.S325429
93
WatanabeT.Baker FrostD. A.MlakarL.HeywoodJ.Da SilveiraW. A.HardimanG.et al (2019). A human skin model recapitulates systemic sclerosis dermal fibrosis and identifies COL22A1 as a TGFbeta early response gene that mediates fibroblast to myofibroblast transition. Genes. (Basel)10. 10.3390/genes10020075
94
WimmerM.ZaunerR.AblingerM.Pinon-HofbauerJ.Guttmann-GruberC.ReisenbergerM.et al (2020). A cancer stem cell-like phenotype is associated with miR-10b expression in aggressive squamous cell carcinomas. Cell. Commun. Signal18, 61. 10.1186/s12964-020-00550-9
95
WitkeW.SharpeA. H.HartwigJ. H.AzumaT.StosselT. P.KwiatkowskiD. J. (1995). Hemostatic, inflammatory, and fibroblast responses are blunted in mice lacking gelsolin. Cell.81, 41–51. 10.1016/0092-8674(95)90369-0
96
WittmannJ.DieckowJ.SchroderH.HampelU.GarreisF.JacobiC.et al (2018). Plasma gelsolin promotes re-epithelialization. Sci. Rep.8, 13140. 10.1038/s41598-018-31441-2
97
XieZ.BaileyA.KuleshovM. V.ClarkeD. J. B.EvangelistaJ. E.JenkinsS. L.et al (2021). Gene set knowledge discovery with Enrichr. Curr. Protoc.1, e90. 10.1002/cpz1.90
98
XueY.WinnickiE.ZhangZ.LopezI.WangS.KirbyC.et al (2025). The mechanotransducer Piezo1 coordinates metabolism and inflammation to promote skin growth. Nat. Commun.16, 6876. 10.1038/s41467-025-62270-3
99
YangH.LvD.LiX.ChenY.XuH.WuH.et al (2025). Comprehensive analysis of keloid super-enhancer networks reveals FOXP1-mediated anti-senescence mechanisms in fibrosis. Cell. Mol. Biol. Lett.30, 88. 10.1186/s11658-025-00763-1
100
YuJ.ZhouZ.WeiZ.WuJ.OuyangJ.HuangW.et al (2020). FYN promotes gastric cancer metastasis by activating STAT3-mediated epithelial-mesenchymal transition. Transl. Oncol.13, 100841. 10.1016/j.tranon.2020.100841
101
YueJ.XieM.GouX.LeeP.SchneiderM. D.WuX. (2014). Microtubules regulate focal adhesion dynamics through MAP4K4. Dev. Cell.31, 572–585. 10.1016/j.devcel.2014.10.025
102
ZhangC.ZhuX.HuaY.ZhaoQ.WangK.ZhenL.et al (2019). YY1 mediates TGF-beta1-induced EMT and pro-fibrogenesis in alveolar epithelial cells. Respir. Res.20, 249. 10.1186/s12931-019-1223-7
103
ZhuH.HeW.YeP.ChenJ.WuX.MuX.et al (2023). Piezo1 in skin wound healing and related diseases: mechanotransduction and therapeutic implications. Int. Immunopharmacol.123, 110779. 10.1016/j.intimp.2023.110779
104
ZulloA.ManciniF. P.SchleipR.WearingS.KlinglerW. (2021). Fibrosis: sirtuins at the checkpoints of myofibroblast differentiation and profibrotic activity. Wound Repair Regen.29, 650–666. 10.1111/wrr.12943
Summary
Keywords
chronic inflammation, DNA methylation, epigenetic reprogramming, keratinocytes, pro-tumorigenic shift, recessive dystrophic epidermolysis bullosa, transcriptome
Citation
Hummel JI, Zauner R, Gruner S, Dorfer S, Ablinger M, Walch V, Barone C, Laimer M, Guttmann-Gruber C, Piñón Hofbauer J, Koller U, Bauer JW and Wally V (2026) Long-term cytokine exposure remodels the methylome and transcriptome of recessive dystrophic epidermolysis bullosa keratinocytes – a bioinformatic analysis. Front. Cell Dev. Biol. 14:1810599. doi: 10.3389/fcell.2026.1810599
Received
13 February 2026
Revised
29 March 2026
Accepted
10 April 2026
Published
07 May 2026
Volume
14 - 2026
Edited by
Lidia Larizza, Italian Auxological Institute (IRCCS), Italy
Reviewed by
Kevin John Keen, University of Northern British Columbia Canada, Canada
Yanling Liao, New York Medical College, United States
Lilli Winter, Medical University of Vienna, Austria
Updates

Check for updates
Copyright
© 2026 Hummel, Zauner, Gruner, Dorfer, Ablinger, Walch, Barone, Laimer, Guttmann-Gruber, Piñón Hofbauer, Koller, Bauer and Wally.
This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.
*Correspondence: Verena Wally, v.wally@salk.at
Disclaimer
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.